Online Inquiry
LEF1 cDNA ORF Clone, Human, N-FLAG tag
SPD-09695
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human lymphoid enhancer-binding factor 1 with N terminal Flag tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | LEF1 |
| Gene Abbr. | LEF1 |
| Gene ID | 51176 |
| Full Name | lymphoid enhancer binding factor 1 |
| Alias | LEF-1, TCF10, TCF1ALPHA, TCF7L3 |
| Introduction | LEF1 and TCF are members of the high mobility group (HMG) DNA binding protein family of transcription factors that consists of the following: Lymphoid Enhancer Factor 1 (LEF1), T Cell Factor 1 (TCF1/TCF7), TCF3/TCF7L1, and TCF4/TCF7L2. LEF1 and TCF1/TCF7 were originally identified as important factors that regulate early lymphoid development and act downstream in Wnt signaling. LEF1 and TCF bind to Wnt response elements to provide docking sites for β-catenin, which translocates to the nucleus to promote the transcription of target genes upon activation of Wnt signaling. LEF1 and TCF are dynamically expressed during development and aberrant activation of the Wnt signaling pathway is involved in many types of cancers, including colon cancer.LEF1 has several isoforms due to alternative splicing. LEF1 also has an alternative promoter that is preferentially active in lymphocytes. The isoforms generated by this alternative promoter have no amino-terminal β-catenin binding domain and may function in a dominant negative manner. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human lymphoid enhancer-binding factor 1 with N terminal Flag tag. |
| NCBI Ref Seq | NM_016269.4 |
| RefSeq ORF Size | 1200 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 624 T/C not causing the amino acid variation. |
| Vector | pCMV3-N-FLAG |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Restriction Sites | KpnI + XbaI (6kb + 1.25kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.