Online Inquiry
LCP2 cDNA ORF Clone, Human, N-HA tag
SPD-13800
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa) with N terminal HA tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | SLP-76 |
| Gene Abbr. | LCP2 |
| Gene ID | 3937 |
| Full Name | lymphocyte cytosolic protein 2 |
| Alias | SLP-76, SLP76 |
| Introduction | SH2 domain-containing leukocyte protein of 76 kDa (SLP-76) is a hematopoietic adaptor protein that is important in multiple biochemical signaling pathways and necessary for T cell development and activation. ZAP-70 phosphorylates SLP-76 and LAT as a result of TCR ligation. SLP-76 has amino-terminal tyrosine residues followed by a proline rich domain and a carboxy-terminal SH2 domain. Phosphorylation of Tyr113 and Tyr128 result in recruitment of the GEF Vav and the adaptor protein Nck. TCR ligation also leads to phosphorylation of Tyr145, which mediates an association between SLP-76 and Itk, which is accomplished in part via the proline rich domain of SLP-76 and the SH3 domain of Itk. Furthermore, the proline rich domain of SLP-76 binds to the SH3 domains of Grb2-like adaptor Gads. In resting cells, SLP-76 is predominantly in the cytosol. Upon TCR ligation, SLP-76 translocates to the plasma membrane and promotes the assembly of a multi-protein signaling complex that includes Vav, Nck, Itk, and PLCγ1. The expression of SLP-76 is tightly regulated; the protein is detected at very early stages of thymocyte development, increases as thymocyte maturation progresses, and is reduced as cells mature to CD4+ CD8+ double-positive thymocytes.Following TCR ligation, SLP-76 is phosphorylated at Ser376 by the hematopoietic progenitor kinase 1 (HPK1). This phosphorylation induces interaction with 14-3-3ε, which leads to the disassembly of TCR signaling complexes and downregulation of TCR signaling. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa) with N terminal HA tag. |
| NCBI Ref Seq | NM_005565.3 |
| RefSeq ORF Size | 1602 bp |
| Vector | pCMV3-N-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.