Lat2 cDNA ORF Clone, Rat, untagged - CD BioSciences

service-banner

Lat2 cDNA ORF Clone, Rat, untagged

Lat2 cDNA ORF Clone, Rat, untagged

SPD-09600

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat linker for activation of T cells family, member 2.
Target Information
Species Rat
Target Name LAT2
Gene Abbr. Lat2
Gene ID 317676
Full Name linker for activation of T cells family, member 2
Alias Ntal, Wbscr5
Product Details
Description Full length Clone DNA of Rat linker for activation of T cells family, member 2.
NCBI Ref Seq NM_173840.1
RefSeq ORF Size 615 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.