Online Inquiry
Lat cDNA ORF Clone, Mouse, N-Myc tag
SPD-09575
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse linker for activation of T cells with N terminal Myc tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | LAT |
Gene Abbr. | Lat |
Gene ID | 16797 |
Full Name | linker for activation of T cells |
Alias | p36-38, pp36 |
Introduction | LAT, a transmembrane adaptor protein expressed in T, NK and mast cells, is an important mediator for T cell receptor (TCR) signaling. Upon TCR engagement, activated Zap-70 phosphorylates LAT at multiple conserved tyrosine residues within SH2 binding motifs, exposing these motifs as the docking sites for downstream signaling targets. The phosphorylation of LAT at Tyr171 and Tyr191 enables the binding of Grb2, Gads/SLP-76, PLCγ1 and PI3 kinase through their SH2 domain and translocates them to the membrane. This process eventually leads to activation of the corresponding signaling pathways. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse linker for activation of T cells with N terminal Myc tag. |
NCBI Ref Seq | NM_010689.2 |
RefSeq ORF Size | 729 bp |
Vector | pCMV3-SP-N-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.