Lat cDNA ORF Clone, Mouse, N-His tag - CD BioSciences

service-banner

Lat cDNA ORF Clone, Mouse, N-His tag

Lat cDNA ORF Clone, Mouse, N-His tag

SPD-09574

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse linker for activation of T cells with N terminal His tag.
Target Information
Species Mouse
Target Name LAT
Gene Abbr. Lat
Gene ID 16797
Full Name linker for activation of T cells
Alias p36-38, pp36
Introduction LAT, a transmembrane adaptor protein expressed in T, NK and mast cells, is an important mediator for T cell receptor (TCR) signaling. Upon TCR engagement, activated Zap-70 phosphorylates LAT at multiple conserved tyrosine residues within SH2 binding motifs, exposing these motifs as the docking sites for downstream signaling targets. The phosphorylation of LAT at Tyr171 and Tyr191 enables the binding of Grb2, Gads/SLP-76, PLCγ1 and PI3 kinase through their SH2 domain and translocates them to the membrane. This process eventually leads to activation of the corresponding signaling pathways.
Product Details
Description Full length Clone DNA of Mouse linker for activation of T cells with N terminal His tag.
NCBI Ref Seq NM_010689.2
RefSeq ORF Size 729 bp
Vector pCMV3-SP-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.