Jdp2 cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Jdp2 cDNA ORF Clone, Mouse, untagged

Jdp2 cDNA ORF Clone, Mouse, untagged

SPD-09442

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse Jun dimerization protein 2.
Target Information
Species Mouse
Target Name JDP2
Gene Abbr. Jdp2
Gene ID 81703
Full Name Jun dimerization protein 2
Alias Jundm, Jundm2, Jundp2, TI, TIF
Product Details
Description Full length Clone DNA of Mouse Jun dimerization protein 2.
NCBI Ref Seq NM_001205052.1
RefSeq ORF Size 492 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.