Online Inquiry
JAK1 Knockout Cell Line
SPL-01748
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 16bp deletion |
| Target Information | |
|---|---|
| Target Name | Jak1 |
| Gene Abbr. | JAK1 |
| Gene ID | 3716 |
| Full Name | Janus kinase 1 |
| Alias | AIIDE, JAK1A, JAK1B, JTK3 |
| Species | Human |
| Genomic Locus | chr1:64883355 |
| Transcript | NM_002227 |
| WT Expression Level | 12.25 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a membrane protein that is a member of a class of protein-tyrosine kinases (PTK) characterized by the presence of a second phosphotransferase-related domain immediately N-terminal to the PTK domain. The encoded kinase phosphorylates STAT proteins (signal transducers and activators of transcription) and plays a key role in interferon-alpha/beta and interferon-gamma signal transduction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 16bp deletion in a coding exon of JAK1. |
| Description | 16bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GGAAGTGATCTTCTATCTGT |
| PCR Primer |
Forward: TGTAAAACGACGGCCAGATTGTACAGATGTGGGGAAATGAGA Reverse: CACTCCCTTTTGCCATAAGAACTTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.