Online Inquiry
Il6st cDNA ORF Clone, Mouse, N-His tag
SPD-06188
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse interleukin 6 signal transducer with N terminal His tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | GP130 |
| Gene Abbr. | Il6st |
| Gene ID | 16195 |
| Full Name | interleukin 6 signal transducer |
| Alias | 5133400A03Rik, AA389424, BB405851, CD130, D13Ertd699 |
| Introduction | GP130 is a signal-transducing subunit shared by the receptors for the IL-6 family of cytokines. The binding of a ligand to its receptor induces the dimerization of GP130, leading to activation of the Jak tyrosine kinase and to tyrosine phosphorylation of GP130. These events lead to the activation of multiple signal-transduction pathways, such as the Stat, Ras-MAPK and PI3 kinase pathways, whose activation is controlled by distinct regions of GP130. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse interleukin 6 signal transducer with N terminal His tag. |
| NCBI Ref Seq | NM_010560.2 |
| RefSeq ORF Size | 2754 bp |
| Vector | pCMV3-SP-N-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.