Il18bp cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Il18bp cDNA ORF Clone, Mouse, untagged

Il18bp cDNA ORF Clone, Mouse, untagged

SPD-07508

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse Interleukin 18 binding protein.
Target Information
Species Mouse
Target Name IL-18 BP
Gene Abbr. Il18bp
Gene ID 16068
Full Name interleukin 18 binding protein
Alias IL-1, IL-18BP, Igi, Igifbp, MC54
Introduction Interleukin-18 is a cytokine and acts as an early signal in the development of the helper T cell (Th1) response. Interleukin-18 Binding Protein (IL-18BP) binds IL-18 and neutralizes the biological activity of IL-18 in vitro. IL-18BP is expressed in the spleen, belongs to the immunoglobulin superfamily, and has limited homology to the IL-1 type II receptor.
Product Details
Description Full length Clone DNA of Mouse Interleukin 18 binding protein.
NCBI Ref Seq NM_010531.1
RefSeq ORF Size 582 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 315C/T not causing the amino acid variation.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites KpnI + XbaI (6.1kb + 0.58kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.