Online Inquiry
Il18bp cDNA ORF Clone, Mouse, C-His tag
SPD-07500
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse Interleukin 18 binding protein with C terminal His tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | IL-18 BP |
Gene Abbr. | Il18bp |
Gene ID | 16068 |
Full Name | interleukin 18 binding protein |
Alias | IL-1, IL-18BP, Igi, Igifbp, MC54 |
Introduction | Interleukin-18 is a cytokine and acts as an early signal in the development of the helper T cell (Th1) response. Interleukin-18 Binding Protein (IL-18BP) binds IL-18 and neutralizes the biological activity of IL-18 in vitro. IL-18BP is expressed in the spleen, belongs to the immunoglobulin superfamily, and has limited homology to the IL-1 type II receptor. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse Interleukin 18 binding protein with C terminal His tag. |
NCBI Ref Seq | NM_010531.1 |
RefSeq ORF Size | 582 bp |
Vector | pCMV3-C-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.