IL17RE cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

IL17RE cDNA ORF Clone, Human, untagged

IL17RE cDNA ORF Clone, Human, untagged

SPD-07489

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human interleukin 17 receptor E.
Target Information
Species Human
Target Name IL-17 Receptor
Gene Abbr. IL17RE
Gene ID 132014
Full Name interleukin 17 receptor E
Product Details
Description Full length Clone DNA of Human interleukin 17 receptor E.
NCBI Ref Seq NM_153480.1
RefSeq ORF Size 2004 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.