Online Inquiry
IL17RC cDNA ORF Clone, Human, untagged
SPD-07468
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human interleukin 17 receptor C |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | IL-17 Receptor |
| Gene Abbr. | IL17RC |
| Gene ID | 84818 |
| Full Name | interleukin 17 receptor C |
| Alias | CANDF9, IL17-RL, IL17RL |
| Introduction | IL-17 receptor C (IL-17 RC; also known as IL-17 RL and IL-17 Rhom) is an 85-110 kDa member of the IL-17 receptor family. This is one of five families that currently comprise the cytokine receptor superfamily. At this time, there are five members within the IL-17 receptor family, and these are termed IL-17 RA, B, C, D, and E. Not all receptors appear to bind known members of the IL-17 cytokine family. To date, IL-17 RA is reported to bind IL-17(A), while IL-17 RB is reported to bind IL‑17B and IL-17E. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human interleukin 17 receptor C |
| NCBI Ref Seq | NM_001203263.1 |
| RefSeq ORF Size | 2124 bp |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV mammalian cell promoter |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.