Il17ra cDNA ORF Clone, Mouse, untagged - CD BioSciences

service-banner

Il17ra cDNA ORF Clone, Mouse, untagged

Il17ra cDNA ORF Clone, Mouse, untagged

SPD-07416

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse interleukin 17 receptor A.
Target Information
Species Mouse
Target Name IL-17 Receptor
Gene Abbr. Il17ra
Gene ID 16172
Full Name interleukin 17 receptor A
Alias AW538159, Cdw217, Il, Il17r, VDw21
Introduction IL-17 R, also known as IL-17 RA, is a 120 kDa type I transmembrane glycoprotein protein that plays a central role in inflammatory responses. Mature mouseIL‑17 R consists of a 291 amino acid (aa) extracellular domain, a 21 aa transmembrane segment, and a 521 aa cytoplasmic domain. The cytoplasmic domain contains a region homologous to the TIR domain of the TLR/IL-1 R family.
Product Details
Description Full length Clone DNA of Mouse interleukin 17 receptor A.
NCBI Ref Seq NM_008359.2
RefSeq ORF Size 2595 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites HindIII + XbaI (6.1kb + 2.6kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.