Il17f cDNA ORF Clone, Mouse, C-His tag - CD BioSciences

service-banner

Il17f cDNA ORF Clone, Mouse, C-His tag

Il17f cDNA ORF Clone, Mouse, C-His tag

SPD-07383

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse interleukin 17 F with C terminal His tag.
Target Information
Species Mouse
Target Name IL-17
Gene Abbr. Il17f
Gene ID 257630
Full Name interleukin 17F
Alias C87042, IL-17F
Introduction The Interleukin 17 (IL-17) family proteins, comprising six members (IL-17, IL-17B through IL-17F), are secreted, structurally related proteins that share a conserved cystine-knot fold near the C-terminus, but have considerable sequence divergence at the N-terminus. With the exception of IL-17B, which exists as a non‑covalently linked dimer, all IL-17 family members are disulfide-linked dimers. IL-17 family proteins are pro‑inflammatory cytokines that induce local cytokine production and are involved in the regulation of immune functions.
Product Details
Description Full length Clone DNA of Mouse interleukin 17 F with C terminal His tag.
NCBI Ref Seq NM_145856.2
RefSeq ORF Size 486 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 462 G/A not causing the amino acid variation.
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Restriction Sites KpnI + XbaI (6kb + 0.53kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.