HSP90B1 cDNA ORF Clone, Human, N-FLAG tag - CD BioSciences

service-banner

HSP90B1 cDNA ORF Clone, Human, N-FLAG tag

HSP90B1 cDNA ORF Clone, Human, N-FLAG tag

SPD-06229

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human heat shock protein 90kDa beta (Grp94), member 1 with N terminal Flag tag.
Target Information
Species Human
Target Name Grp94
Gene Abbr. HSP90B1
Gene ID 7184
Full Name heat shock protein 90 beta family member 1
Alias ECGP, GP96, GRP94, HEL-S-125m, HEL35
Introduction Secretory proteins are synthesized on polysomes and translocated into the endoplasmic reticulum (ER). Inside ER, these proteins are often modified by disulfide bond formation, amino-linked glycosylation and folding. The ER contains a pool of molecular chaperones, including Grp94, to help ensure correct protein folding. Grp94 is a glucose-regulated protein with sequence homology to Hsp90. In addition to its role in helping to facilitate folding of a number of secretory proteins to their correct conformation, studies suggest that Grp94 derived from cancer cells also induces anti-tumor immune responses in mouse tumor models. One way in which Grp94 promotes tumor immunogenicity is its ability to bind to and present tumor-derived peptides as antigens. Furthermore, Grp94 has also been shown to induce maturation of dendritic cells. Taken together, Grp94 functions both as a tumor-specific antigen and as an activator of antigen-presenting cells to elicit an anti-cancer immune response.
Product Details
Description Full length Clone DNA of Human heat shock protein 90kDa beta (Grp94), member 1 with N terminal Flag tag.
NCBI Ref Seq NM_003299.2
RefSeq ORF Size 2436 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-SP-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI (three restriction sites) + XbaI (6kb + 0.52kb + 0.98kb + 0.95kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.