Online Inquiry
Hmgn1 cDNA ORF Clone, Mouse, C-Myc tag
SPD-06467
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse high mobility group nucleosomal binding domain 1 with C terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | HMGN1 |
| Gene Abbr. | Hmgn1 |
| Gene ID | 15312 |
| Full Name | high mobility group nucleosomal binding domain 1 |
| Alias | HMG-14, Hmg14 |
| Introduction | High mobility group (HMG) proteins are a superfamily of abundant and ubiquitous nuclear proteins that bind DNA without sequence specificity and induce structural changes to the chromatin fiber to regulate access to the underlying DNA. The HMGN family of proteins, which includes five members (HMGN1-5), is characterized by the presence of several conserved protein domains: a positively charged domain, a nucleosome binding domain, and an acidic C-terminal chromatin-unfolding domain. HMGN proteins function in transcriptional regulation and are recruited to gene promoters by transcription factors, such as estrogen receptor α (ERα), serum responsive factor (SRF), and PITX2, where they can facilitate either gene activation or repression. HMGN proteins bind specifically to nucleosomal DNA and reduce compaction of the chromatin fiber, in part by competing with linker histone H1 for nucleosome binding. In addition, HMGN proteins act to modulate local levels of post-translational histone modifications, decreasing phosphorylation of histone H3 at Ser10 and histone H2A at Ser1 and increasing acetylation of histone H3 at Lys14. HMGN proteins can also modulate the activity of several chromatin-remodeling factors and restrict nucleosome mobility.HMGN1 (also known as HMG14) expression is tightly linked to cellular differentiation. HMGN1 is ubiquitous and highly expressed in all embryonic tissues. During mouse embryogenesis, expression is down-regulated throughout the embryo, except in committed but continuously renewing cell types undergoing active differentiation, such as the basal layer of the epithelium and kidney cells undergoing mesenchyme to epithelium transition. HMGN1 expression is also down-regulated during myogenesis, erythropoiesis, and osteogenesis. Over-expression of HMGN1 inhibits myotube formation in C2C12 myoblast cells and chondrocyte differentiation in primary limb bud mesenchymal cells, suggesting a role in blocking cellular differentiation. HGMN1-/- mice appear normal, most likely due to partial redundancy with other family members such as HMGN2. However, these mice are hypersensitive to various stress conditions, including exposure to UV light and ionizing radiation (IR). Further studies have shown that HMGN1 is required for efficient transcription-coupled repair (TCR) following UV treatment, and proper activation of ATM following IR treatment, both of which require HMGN1 chromatin binding activity, suggesting a direct role for HMGN1 in chromatin remodeling during DNA repair. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse high mobility group nucleosomal binding domain 1 with C terminal Myc tag. |
| NCBI Ref Seq | NM_008251.3 |
| RefSeq ORF Size | 291 bp |
| Vector | pCMV3-C-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.