Gsk3b cDNA ORF Clone, Mouse, C-Myc tag - CD BioSciences

service-banner

Gsk3b cDNA ORF Clone, Mouse, C-Myc tag

Gsk3b cDNA ORF Clone, Mouse, C-Myc tag

SPD-06236

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse glycogen synthase kinase 3 beta with C terminal Myc tag.
Target Information
Species Mouse
Target Name GSK-3
Gene Abbr. Gsk3b
Gene ID 56637
Full Name glycogen synthase kinase 3 beta
Alias 7330414F15Rik, 8430431H08Rik, C86142, GSK, GSK-
Introduction Glycogen synthase kinase-3 (GSK-3) was initially identified as an enzyme that regulates glycogen synthesis in response to insulin. GSK-3 is a ubiquitously expressed serine/threonine protein kinase that phosphorylates and inactivates glycogen synthase. GSK-3 is a critical downstream element of the PI3K/Akt cell survival pathway whose activity can be inhibited by Akt-mediated phosphorylation at Ser21 of GSK-3α and Ser9 of GSK-3β. GSK-3 has been implicated in the regulation of cell fate in Dictyostelium and is a component of the Wnt signaling pathway required for Drosophila, Xenopus, and mammalian development. GSK-3 has been shown to regulate cyclin D1 proteolysis and subcellular localization.
Product Details
Description Full length Clone DNA of Mouse glycogen synthase kinase 3 beta with C terminal Myc tag.
NCBI Ref Seq NM_019827.6
RefSeq ORF Size 1263 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites KpnI + XbaI (6kb + 1.31kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.