Online Inquiry
GRB2 cDNA ORF Clone, Human, C-FLAG tag
SPD-06202
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human growth factor receptor-bound protein 2 with C terminal Flag tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | GRB2 |
| Gene Abbr. | GRB2 |
| Gene ID | 2885 |
| Full Name | growth factor receptor bound protein 2 |
| Alias | ASH, EGFRBP-GRB2, Grb3-3, MST084, MSTP084 |
| Introduction | Growth factor receptor-binding protein 2 (GRB2) is an adaptor protein that is involved in RTK signal transduction. The SH2 domain of GRB2 binds to tyrosine phosphorylated proteins such as EGFR, IRS-1, Shc and Gab1. The SH3 domain of GRB2 associates with Sos, which stimulates the GTP binding activity of Ras, leading to the activation of the MAP kinase and other signaling pathways. Phosphorylation of Tyr209 of GRB2 by Bcr-Abl and EGFR abolishes its association with Sos and negatively regulates downstream signaling. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human growth factor receptor-bound protein 2 with C terminal Flag tag. |
| NCBI Ref Seq | NM_002086.4 |
| RefSeq ORF Size | 654 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-C-FLAG |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Restriction Sites | KpnI + XbaI (6kb + 0.69kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.