Online Inquiry
GLRX3 cDNA ORF Clone, Human, untagged
SPD-06120
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human protein kinase C, theta. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Glutaredoxin |
| Gene Abbr. | GLRX3 |
| Gene ID | 10539 |
| Full Name | glutaredoxin 3 |
| Alias | GLRX4, GRX3, GRX4, PICOT, TXNL2 |
| Introduction | This gene encodes a member of the glutaredoxin family. Glutaredoxins are oxidoreductase enzymes that reduce a variety of substrates using glutathione as a cofactor. The encoded protein binds to and modulates the function of protein kinase C theta. The encoded protein may also inhibit apoptosis and play a role in cellular growth, and the expression of this gene may be a marker for cancer. Pseudogenes of this gene are located on the short arm of chromosomes 6 and 9. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq] |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human protein kinase C, theta. |
| NCBI Ref Seq | NM_006257.3 |
| RefSeq ORF Size | 2121 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 2.12kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.