Online Inquiry
GAB1 cDNA ORF Clone, Human, C-His tag
SPD-05924
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human GRB2-associated binding protein 1 with C terminal His tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | GAB1 |
| Gene Abbr. | GAB1 |
| Gene ID | 2549 |
| Full Name | GRB2 associated binding protein 1 |
| Alias | DFNB26 |
| Introduction | The Grb-associated binder (Gab) family is a family of adaptor proteins recruited by a wide variety of receptor tyrosine kinases (RTKs) such as EGFR, HGFR, insulin receptor, cytokine receptor and B cell antigen receptors. Upon stimulation of RTKs by their cognate ligand, Gab is recruited to the plasma membrane where it is phosphorylated and functions as a scaffold. Multiple tyrosine phosphorylation sites of Gab1 protein have been identified. Phosphorylation of Tyr472 regulates its binding to p85 PI3 kinase. Phosphorylation of Gab1 at Tyr307, Tyr373 and Tyr407 modulates its association to PLCγ. Phosphorylation of Tyr627 and Tyr659 is required for Gab1 binding to and activation of the protein tyrosine phosphatase SHP2. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human GRB2-associated binding protein 1 with C terminal His tag. |
| NCBI Ref Seq | BC064848 |
| RefSeq ORF Size | 2220 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-C-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Restriction Sites | KpnI + XbaI (6kb + 2.22kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.