Online Inquiry
Fzd5 cDNA ORF Clone, Mouse, untagged
SPD-05776
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse frizzled homolog 5 (Drosophila). |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | Frizzled-5 |
| Gene Abbr. | Fzd5 |
| Gene ID | 14367 |
| Full Name | frizzled class receptor 5 |
| Alias | 5330434N09Rik, AI427138, Fz-5, Fz5, mFz5 |
| Introduction | Frizzled (Fzd) belongs to the seven transmembrane-spanning G-protein-coupled receptor (GPCR) superfamily. Fzds have a large extracellular N-terminal region containing a cysteine-rich domain (CRD), which is involved in binding to Wnt proteins. The intracellular C-terminus binds to the PDZ domain of Dvl proteins, a major signaling component downstream of Fzd. Wnt proteins bind to Fzd and the co-receptors LRP5 or LPR6, and activate Wnt/β-catenin pathway through inhibiting phosphorylation of β-catenin by GSK3-β. In addition to this canonical Wnt/β-catenin pathway, some Wnt proteins can also activate the Fzd/Ca2+ pathway and Fzd/PCP (planar cell polarity) pathway. The mammalian Fzd subfamily has 10 members (Fzd1 to Fzd10) and they may mediate signaling through different pathways. Some Fzds can also bind to other secreted proteins, like Norrin and R-Spondin. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse frizzled homolog 5 (Drosophila). |
| NCBI Ref Seq | NM_001042659.1 |
| RefSeq ORF Size | 1758 bp |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.