Online Inquiry
FKBP1A Knockout Cell Line
SPL-01404
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | FKBP12 |
| Gene Abbr. | FKBP1A |
| Gene ID | 2280 |
| Full Name | FKBP prolyl isomerase 1A |
| Alias | FKBP-12, FKBP-1A, FKBP1, FKBP12, PKC12 |
| Species | Human |
| Genomic Locus | chr20:1392847 |
| Transcript | NM_000801 |
| WT Expression Level | 243.07 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. The protein is a cis-trans prolyl isomerase that binds the immunosuppressants FK506 and rapamycin. It interacts with several intracellular signal transduction proteins including type I TGF-beta receptor. It also interacts with multiple intracellular calcium release channels, and coordinates multi-protein complex formation of the tetrameric skeletal muscle ryanodine receptor. In mouse, deletion of this homologous gene causes congenital heart disorder known as noncompaction of left ventricular myocardium. Multiple alternatively spliced variants, encoding the same protein, have been identified. The human genome contains five pseudogenes related to this gene, at least one of which is transcribed. [provided by RefSeq, Sep 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of FKBP1A. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CACGCAGGTCTGGCCGCGCT |
| PCR Primer |
Forward: GCATCTAAGGTGCAGAAATGCTTC Reverse: GGACCCCCTATTATTACTCCCATTC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.