Online Inquiry
Fas cDNA ORF Clone, Mouse, C-His tag
SPD-05471
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse Fas (TNF receptor superfamily member 6) with C terminal His tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | Fas |
| Gene Abbr. | Fas |
| Gene ID | 14102 |
| Full Name | Fas (TNF receptor superfamily member 6) |
| Alias | AI196731, AP, APO1, APT1, CD95 |
| Introduction | Association of the receptor Fas with its ligand FasL triggers an apoptotic pathway that plays an important role in immune regulation, development, and progression of cancers. Loss of function mutation in either Fas (lpr mice) or FasL (gld mice) leads to lymphadenopathy and splenomegaly as a result of decreased apoptosis in CD4-CD8- T lymphocytes. FasL (CD95L, Apo-1L) is a type II transmembrane protein of 280 amino acids (runs at approximately 40 kDa upon glycosylation) that belongs to the TNF family, which also includes TNF-α, TRAIL, and TWEAK. Binding of FasL to its receptor triggers the formation of a death-inducing signaling complex (DISC) involving the recruitment of the adaptor protein FADD and caspase-8. Activation of caspase-8 from this complex initiates a caspase cascade resulting in the activation of caspase-3 and subsequent cleavage of proteins leading to apoptosis. Unlike Fas, which is constitutively expressed by various cell types, FasL is predominantly expressed on activated T lymphocytes, NK cells, and at immune privileged sites. FasL is also expressed in several tumor types as a mechanism to evade immune surveillance. Similar to other members of the TNF family, FasL can be cleaved by metalloproteinases producing a 26 kDa trimeric soluble form. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse Fas (TNF receptor superfamily member 6) with C terminal His tag. |
| NCBI Ref Seq | NM_007987.1 |
| RefSeq ORF Size | 984 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 234 C>T, 330G>A, and 456 G>A not causing the amino acid variation. |
| Vector | pCMV3-C-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Restriction Sites | HindIII + NotI (6kb + 1.03kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.