Online Inquiry
EPHB6 cDNA ORF Clone, Human, C-HA tag
SPD-05319
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human EPH receptor B6 with C terminal HA tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | EphB6 |
| Gene Abbr. | EPHB6 |
| Gene ID | 2051 |
| Full Name | EPH receptor B6 |
| Alias | HEP |
| Introduction | Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The ephrin receptor encoded by this gene lacks the kinase activity of most receptor tyrosine kinases and binds to ephrin-B ligands. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human EPH receptor B6 with C terminal HA tag. |
| NCBI Ref Seq | NM_004445.2 |
| RefSeq ORF Size | 3021 bp |
| Vector | pCMV3-C-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.