Online Inquiry
Egfr cDNA ORF Clone, Mouse, C-FLAG tag
SPD-04962
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse epidermal growth factor receptor with C terminal Flag tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | EGFR |
| Gene Abbr. | Egfr |
| Gene ID | 13649 |
| Full Name | epidermal growth factor receptor |
| Alias | 9030024J15Rik, AI552599, Erb, Erbb, Err |
| Introduction | The epidermal growth factor (EGF) receptor is a transmembrane tyrosine kinase that belongs to the HER/ErbB protein family. Ligand binding results in receptor dimerization, autophosphorylation, activation of downstream signaling, internalization, and lysosomal degradation. Phosphorylation of EGF receptor (EGFR) at Tyr845 in the kinase domain is implicated in stabilizing the activation loop, maintaining the active state enzyme, and providing a binding surface for substrate proteins. c-Src is involved in phosphorylation of EGFR at Tyr845. The SH2 domain of PLCγ binds at phospho-Tyr992, resulting in activation of PLCγ-mediated downstream signaling. Phosphorylation of EGFR at Tyr1045 creates a major docking site for the adaptor protein c-Cbl, leading to receptor ubiquitination and degradation following EGFR activation. The GRB2 adaptor protein binds activated EGFR at phospho-Tyr1068. A pair of phosphorylated EGFR residues (Tyr1148 and Tyr1173) provide a docking site for the Shc scaffold protein, with both sites involved in MAP kinase signaling activation. Phosphorylation of EGFR at specific serine and threonine residues attenuates EGFR kinase activity. EGFR carboxy-terminal residues Ser1046 and Ser1047 are phosphorylated by CaM kinase II; mutation of either of these serines results in upregulated EGFR tyrosine autophosphorylation. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse epidermal growth factor receptor with C terminal Flag tag. |
| NCBI Ref Seq | NM_207655.2 |
| RefSeq ORF Size | 3633 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 40 T>C, 1725 A>G and 2799 G>A not causing the amino acid variation. |
| Vector | pCMV3-C-FLAG |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Restriction Sites | KpnI + NotI (6kb + 3.68kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.