Online Inquiry
Egf cDNA ORF Clone, Mouse, C-Myc tag
SPD-04861
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse epidermal growth factor with C terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | EGF |
| Gene Abbr. | Egf |
| Gene ID | 13645 |
| Full Name | epidermal growth factor |
| Alias | AI790464 |
| Introduction | EGF is the prototypic member of a family of growth factors that are characterized by the presence of EGF like domains and activate members of the EGF receptor family. Proteolytic cleavage of a membrane-bound precursor releases mature soluble EGF which interacts with the EGF R to promote proliferation and differentiation of mesenchymal and epithelial cells. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse epidermal growth factor with C terminal Myc tag. |
| NCBI Ref Seq | NM_010113.3 |
| RefSeq ORF Size | 3654 bp |
| Vector | pCMV3-C-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.