Online Inquiry
Edil3 cDNA ORF Clone, Mouse, C-HA tag
SPD-04802
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse EGF-like repeats and discoidin I-like domains 3 with C terminal HA tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | EDIL3/DEL1 |
| Gene Abbr. | Edil3 |
| Gene ID | 13612 |
| Full Name | EGF-like repeats and discoidin I-like domains 3 |
| Alias | Del, Del-, Del-1, Del1, Sox2-cre |
| Introduction | The protein encoded by this gene is an integrin ligand. It plays an important role in mediating angiogenesis and may be important in vessel wall remodeling and development. It also influences endothelial cell behavior. [provided by RefSeq] |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse EGF-like repeats and discoidin I-like domains 3 with C terminal HA tag. |
| NCBI Ref Seq | NM_001037987.3 |
| RefSeq ORF Size | 1485 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1284A/G not causing the amino acid variation. |
| Vector | pCMV3-C-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Restriction Sites | KpnI + XbaI (6kb + 1.49kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.