Online Inquiry
Dll1 cDNA ORF Clone, Mouse, N-HA tag
SPD-04597
| Size | Price | 
| 1 Unit | Online Inquiry | 
| Description | 
|---|
| Full length Clone DNA of Mouse delta-like 1 (Drosophila) with N terminal HA tag. | 
| Target Information | |
|---|---|
| Species | Mouse | 
| Target Name | DLL1 | 
| Gene Abbr. | Dll1 | 
| Gene ID | 13388 | 
| Full Name | delta like canonical Notch ligand 1 | 
| Alias | Delt, Delta1 | 
| Introduction | Notch signaling is activated upon engagement of the Notch receptor with its ligands, the DSL (Delta, Serrate, Lag2) proteins of single-pass type I membrane proteins. The DSL proteins contain multiple EGF-like repeats and a DSL domain that is required for binding to Notch. Five DSL proteins have been identified in mammals: Jagged1, Jagged2, Delta-like (DLL) 1, 3 and 4. Ligand binding to the Notch receptor results in two sequential proteolytic cleavages of the receptor by the ADAM protease and the γ-secretase complex. The intracellular domain of Notch is released and then translocates to the nucleus where it activates transcription. Notch ligands may also be processed in a way similar to Notch, suggesting a bi-directional signaling through receptor-ligand interactions. | 
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse delta-like 1 (Drosophila) with N terminal HA tag. | 
| NCBI Ref Seq | NM_007865.3 | 
| RefSeq ORF Size | 2169 bp | 
| Vector | pCMV3-SP-N-HA | 
| Promoter | Enhanced CMV promoter | 
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC | 
| Quality Control | The plasmid is confirmed by full-length sequencing. | 
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. | 
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); | 
| Antibiotic in E.coli | Kanamycin | 
| Antibiotic in Mammalian cell | Hygromycin | 
| Application | Stable or Transient mammalian expression | 
| Shipping | Each tube contains lyophilized plasmid. | 
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. | 
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.