Online Inquiry
DLK1 cDNA ORF Clone, Human, C-FLAG tag
SPD-04559
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human delta-like 1 homolog (Drosophila) with C terminal Flag tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | DLK1 |
| Gene Abbr. | DLK1 |
| Gene ID | 8788 |
| Full Name | delta like non-canonical Notch ligand 1 |
| Alias | DLK, DLK-1, Delta1, FA1, PREF1 |
| Introduction | This gene encodes a transmembrane protein containing six epidermal growth factor repeats. The protein is involved in the differentiation of several cell types, including adipocytes; it is also thought to be a tumor suppressor. It is one of several imprinted genes located in a region of on chr 14q32. Certain mutations in this imprinted region can cause phenotypes similar to maternal and paternal uniparental disomy of chromosome 14 (UPD14). This gene is expressed from the paternal allele. A polymorphism within this gene has been associated with child and adolescent obesity. The mode of inheritance for this polymorphism is polar overdominance; this non-Mendelian inheritance pattern was first described in sheep with the callipyge phenotype, which is characterized by muscle hypertrophy and decreased fat mass. [provided by RefSeq] |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human delta-like 1 homolog (Drosophila) with C terminal Flag tag. |
| NCBI Ref Seq | BC007741 |
| RefSeq ORF Size | 1152 bp |
| Vector | pCMV3-C-FLAG |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.