Online Inquiry
Ddit3 cDNA ORF Clone, Mouse, N-HA tag
SPD-03352
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse DNA-damage inducible transcript 3 with N terminal HA tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | CHOP |
| Gene Abbr. | Ddit3 |
| Gene ID | 13198 |
| Full Name | DNA-damage inducible transcript 3 |
| Alias | AltDDIT3, CHOP-, CHOP-10, CHOP10, ch |
| Introduction | CHOP was identified as a C/EBP-homologous protein that inhibits C/EBP and LAP in a dominant-negative manner. CHOP expression is induced by certain cellular stresses including starvation and the induced CHOP suppresses cell cycle progression from G1 to S phase. Later it was shown that, during ER stress, the level of CHOP expression is elevated and CHOP functions to mediate programmed cell death. Studies also found that CHOP mediates the activation of GADD34 and Ero1-Lα expression during ER stress. GADD34 in turn dephosphorylates phospho-Ser51 of eIF2α thereby stimulating protein synthesis. Ero1-Lα promotes oxidative stress inside the endoplasmic reticulum. The role of CHOP in the programmed cell death of ER-stressed cells is correlated with its role promoting protein synthesis and oxidative stress inside the ER. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse DNA-damage inducible transcript 3 with N terminal HA tag. |
| NCBI Ref Seq | NM_007837.4 |
| RefSeq ORF Size | 507 bp |
| Vector | pCMV3-N-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.