Online Inquiry
DAXX Knockout Cell Line
SPL-01102
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 218bp insertion |
| Target Information | |
|---|---|
| Target Name | Daxx |
| Gene Abbr. | DAXX |
| Gene ID | 1616 |
| Full Name | death domain associated protein |
| Alias | BING2, DAP6, EAP1, SMIM40 |
| Species | Human |
| Genomic Locus | chr6:33321427 |
| Transcript | NM_001141969 |
| WT Expression Level | 88.70 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a multifunctional protein that resides in multiple locations in the nucleus and in the cytoplasm. It interacts with a wide variety of proteins, such as apoptosis antigen Fas, centromere protein C, and transcription factor erythroblastosis virus E26 oncogene homolog 1. In the nucleus, the encoded protein functions as a potent transcription repressor that binds to sumoylated transcription factors. Its repression can be relieved by the sequestration of this protein into promyelocytic leukemia nuclear bodies or nucleoli. This protein also associates with centromeres in G2 phase. In the cytoplasm, the encoded protein may function to regulate apoptosis. The subcellular localization and function of this protein are modulated by post-translational modifications, including sumoylation, phosphorylation and polyubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 218bp insertion in a coding exon of DAXX. |
| Description | 218bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CTAGGGTCCTGTCTCGGGCC |
| PCR Primer |
Forward: GAGGCAGTGTTTTCAGCATTTGTG Reverse: CCTTGAACTTTGTAAGATGCAGACA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.