Online Inquiry
DAPK3 cDNA ORF Clone, Human, untagged
SPD-04452
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human death-associated protein kinase 3. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | DAPK3 |
| Gene Abbr. | DAPK3 |
| Gene ID | 1613 |
| Full Name | death associated protein kinase 3 |
| Alias | DLK, ZIP, ZIPK |
| Introduction | DAPK3, a DAPK type protein kinase, is functions in apoptotic signaling and also is believed to function in coordination of specific transcription and splicing events. DAPK3 contains a leucine zipper motif at its C terminus in addition to the N terminal kinase domain. DAPK3 binds to ATF4, a member of the activating transcription factor/cyclic AMP-responsive element-binding protein (ATF/CREB) family. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human death-associated protein kinase 3. |
| NCBI Ref Seq | NM_001348.1 |
| RefSeq ORF Size | 1365 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 18 G>A and 324 A>G not causing the amino acid variation. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | HindIII + XbaI (6.1kb + 1.37kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.