Online Inquiry
CSK cDNA ORF Clone, Human, untagged
SPD-04024
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human c-src tyrosine kinase. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Csk |
| Gene Abbr. | CSK |
| Gene ID | 1445 |
| Full Name | C-terminal Src kinase |
| Introduction | Carboxy-terminal Src kinase (Csk) is a ubiquitously expressed nonreceptor tyrosine kinase that negatively regulates the Src family kinases (SFKs) by phosphorylation of the SFK carboxy-terminal tyrosine. Phosphorylated carboxy-terminal tyrosine binds to the SH2 domain of SFK intramolecularly and leads to folding and inactivation of the SFK. This Csk-catalyzed SFK tyrosine phosphorylation is highly specific and exclusive. The SFK carboxy-terminal tyrosine is the only known physiological substrate of Csk.Csk consists of an SH2, an SH3, and a kinase domain. There is evidence that the SH2 and SH3 domains are essential for the regulation of SFK, and Csk can be recruited to the membrane where SFKs are in an active state. This process is mediated by a Csk-binding protein (Cbp, also called PAG), which binds tightly to the SH2 domain of Csk. Activation of SFK by extracellular stimuli leads to the tyrosine phosphorylation of Cbp, generating docking sites for Csk. The recruitment of Csk forms a feedback mechanism for termination of SFK function. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human c-src tyrosine kinase. |
| NCBI Ref Seq | NM_001127190.1 |
| RefSeq ORF Size | 1353 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | HindIII + XbaI (6.1kb + 1.35kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.