Online Inquiry
CRADD cDNA ORF Clone, Human, untagged
SPD-12994
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human CASP2 and RIPK1 domain containing adaptor with death domain |
Target Information | |
---|---|
Species | Human |
Target Name | RAIDD |
Gene Abbr. | CRADD |
Gene ID | 8738 |
Full Name | CASP2 and RIPK1 domain containing adaptor with death domain |
Alias | MRT34, RAIDD |
Introduction | CRADD (Caspase and RIP adapter with death domain; also RAIDD) is a 22 kDa, widely-expressed cytosolic adaptor protein that participates in apoptosis. Mouse CRADD is 199 amino acids (aa) in length. It contains an N-terminal CARD region (aa 1‑92) and a C-terminal DD/death domain (aa 116‑188). The CARD interacts with caspase-2, while the DD recruits either PIDD or RIP. These interactions contribute to the activation of an apoptotic cascade. Mouse CRADD shows two potential additional isoforms. One shows an alternate start site at Met55, while a second shows a 70 aa substitution for aa’s 101‑199. Mouse CRADD shares 90% and 95% aa identity with human and rat CRADD, respectively. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human CASP2 and RIPK1 domain containing adaptor with death domain |
NCBI Ref Seq | NM_003805.3 |
RefSeq ORF Size | 600 bp |
Vector | pCMV3-untagged |
Promoter | Enhanced CMV mammalian cell promoter |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Ampicillin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.