Online Inquiry
CHUK Knockout Cell Line
SPL-00969
| Size | Price | 
| 1 Unit | Online Inquiry | 
| Description | 
|---|
| 26bp deletion | 
| Target Information | |
|---|---|
| Target Name | IKKα | 
| Gene Abbr. | CHUK | 
| Gene ID | 1147 | 
| Full Name | component of inhibitor of nuclear factor kappa B kinase complex | 
| Alias | IKBKA, IKK-alpha, IKK1, IKKA, NFKBIKA | 
| Species | Human | 
| Genomic Locus | chr10:100229443 | 
| Transcript | NM_001278 | 
| WT Expression Level | 19.24 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) | 
| Introduction | This gene encodes a member of the serine/threonine protein kinase family. The encoded protein, a component of a cytokine-activated protein complex that is an inhibitor of the essential transcription factor NF-kappa-B complex, phosphorylates sites that trigger the degradation of the inhibitor via the ubiquination pathway, thereby activating the transcription factor. [provided by RefSeq, Jul 2008]. | 
| Product Details | |
|---|---|
| Cell Line Model | HAP1 | 
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 26bp deletion in a coding exon of CHUK. | 
| Description | 26bp deletion | 
| Parental Cell Line | C631 | 
| Guide RNA Sequence | ACAGACGTTCCCGAAGCCGC | 
| PCR Primer | 
                            Forward: TGTAAAACGACGGCCAGTCAAATACAACTTTGGACACACAGG Reverse: TGGGGTTTGGAGAGATCTTATGTTT  | 
                    
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. | 
| Culture Medium | IMDM + 10% FCS | 
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. | 
| Freeze Medium | IMDM + 20% FCS + 10% DMSO | 
| Biosafety Level | BSL-1 | 
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. | 
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.