Online Inquiry
CDKN1A cDNA ORF Clone, Human, N-His tag
SPD-10904
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human cyclin-dependent kinase inhibitor 1A (p21, Cip1) with N terminal His tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | p21 Waf1/Cip1 |
| Gene Abbr. | CDKN1A |
| Gene ID | 1026 |
| Full Name | cyclin dependent kinase inhibitor 1A |
| Alias | CAP20, CDKN1, CIP1, MDA-6, P21 |
| Introduction | The tumor suppressor protein p21 Waf1/Cip1 acts as an inhibitor of cell cycle progression. It functions in stoichiometric relationships forming heterotrimeric complexes with cyclins and cyclin-dependent kinases. In association with CDK2 complexes, it serves to inhibit kinase activity and block progression through G1/S. However, p21 may also enhance assembly and activity in complexes of CDK4 or CDK6 and cyclin D. The carboxy-terminal region of p21 is sufficient to bind and inhibit PCNA, a subunit of DNA polymerase, and may coordinate DNA replication with cell cycle progression. Upon UV damage or during cell cycle stages when cdc2/cyclin B or CDK2/cyclin A are active, p53 is phosphorylated and upregulates p21 transcription via a p53-responsive element. Protein levels of p21 are downregulated through ubiquitination and proteasomal degradation. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human cyclin-dependent kinase inhibitor 1A (p21, Cip1) with N terminal His tag. |
| NCBI Ref Seq | NM_000389.3 |
| RefSeq ORF Size | 540 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-N-His |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
| Restriction Sites | KpnI + XbaI (6kb + 0.54kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.