CDK8 cDNA ORF Clone, Human, C-His tag - CD BioSciences

service-banner

CDK8 cDNA ORF Clone, Human, C-His tag

CDK8 cDNA ORF Clone, Human, C-His tag

SPD-03275

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human cyclin-dependent kinase 8 with C terminal His tag.
Target Information
Species Human
Target Name CDK8
Gene Abbr. CDK8
Gene ID 1024
Full Name cyclin dependent kinase 8
Alias IDDHBA, K35
Introduction The mammalian Mediator Complex is a multi-subunit protein complex that couples specific transcriptional regulators to RNA polymerase II (Pol II) and the basal transcription machinery. Interactions between distinct Mediator subunits and transcription factors allow for specific gene regulation.Mediator complex interactions control various biological processes, including insulin signaling NF-κB-dependent signaling stem cell pluripotency and self renewal, and proliferation of colon cancer cells.CDK8/Cyclin C, along with Med12 and Med13, constitute a subcomplex within the Mediator Complex thought to act as a molecular switch, inhibiting Pol II recruitment and transcription initiation. Expression of CDK8 abrogates E2F-1-dependent inhibition of β-catenin activity in colon cancer cells. High levels of CDK8 coincide with high β-catenin-dependent transcription in colon cancer cells, and their proliferation can be inhibited by suppressing CDK8 expression.CDK8 can phosphorylate Ser727 on STAT1, which reduces natural killer (NK) cell toxicity. As such, inhibitors are being pursued as potential therapeutics to enhance NK cell activity and combat a variety of cancer types.
Product Details
Description Full length Clone DNA of Human cyclin-dependent kinase 8 with C terminal His tag.
NCBI Ref Seq NM_001260.1
RefSeq ORF Size 1440 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Restriction Sites HindIII + NotI (6kb + 1.44kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.