Online Inquiry
CCR2 cDNA ORF Clone, Human, C-HA tag
SPD-02522
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human chemokine (C-C motif) receptor 2 with C terminal HA tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | CCR2 |
| Gene Abbr. | CCR2 |
| Gene ID | 729230 |
| Full Name | C-C motif chemokine receptor 2 |
| Alias | CC-CKR-2, CCR-2, CCR2A, CCR2B, CD192 |
| Introduction | CCR2, or C-C chemokine receptor type 2, is a receptor for several monocyte chemo attractant proteins (MCP1, MCP3, MCP4) which specifically mediate monocyte chemotaxis. CCR2 transduces such signals by increasing the intracellular level of calcium ions. For example, MCP1 is involved in monocyte infiltration in inflammatory diseases such as rheumatoid arthritis as well as in the inflammatory response against tumors. CCR2 is also an alternative coreceptor with CD4 for HIV1 infection. CCR2 has two isoforms and has been reported to be expressed in a wide variety of tissues, including blood, brain, heart, kidney, liver, lung, ovary, pancreas, spinal cord, spleen and thymus. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human chemokine (C-C motif) receptor 2 with C terminal HA tag. |
| NCBI Ref Seq | NM_001123041.2 |
| RefSeq ORF Size | 1167 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-C-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Restriction Sites | KpnI + XbaI (6kb + 1.17kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.