Online Inquiry
CBL cDNA ORF Clone, Human, C-Myc tag
SPD-02389
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human Cas-Br-M (murine) ecotropic retroviral transforming sequence with C terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | c-Cbl |
| Gene Abbr. | CBL |
| Gene ID | 867 |
| Full Name | Cbl proto-oncogene |
| Alias | C-CBL, CBL2, FRA11B, NSLL, RNF55 |
| Introduction | The c-Cbl proto-oncogene is a ubiquitously expressed cytoplasmic adaptor protein that is especially predominant in hematopoietic cells. c-Cbl is rapidly tyrosine-phosphorylated in response to stimulation of a variety of cell-surface receptors and becomes associated with a number of intracellular signaling molecules such as protein tyrosine kinases, phosphatidylinositol-3 kinase, Crk, and 14-3-3 proteins. c-Cbl possesses a highly conserved amino-terminal phosphotyrosine binding domain (TKB) and a C3HC4 RING finger motif. The TKB recognizes phosphorylated tyrosines on activated receptor tyrosine kinases (RTKs) as well as other nonreceptor tyrosine kinases. The RING finger motif recruits ubiquitin-conjugating enzymes. These two domains are primarily responsible for the ubiquitin ligase activity of c-Cbl and downregulation of RTKs. Research studies have indicated that in human cancer tissues, c-Cbl is frequently tyrosine-phosphorylated in a tumor-specific manner. Phosphorylation of Tyr731 of c-Cbl provides a docking site for downstream signaling components such as p85 and Fyn. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human Cas-Br-M (murine) ecotropic retroviral transforming sequence with C terminal Myc tag. |
| NCBI Ref Seq | NM_005188.2 |
| RefSeq ORF Size | 2766 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-C-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Restriction Sites | KpnI + XbaI (6kb + 2.77kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.