Online Inquiry
CASP7 Knockout Cell Line
SPL-00788
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp deletion |
| Target Information | |
|---|---|
| Target Name | Caspase-7 |
| Gene Abbr. | CASP7 |
| Gene ID | 840 |
| Full Name | caspase 7 |
| Alias | CASP-7, CMH-1, ICE-LAP3, LICE2, MCH3 |
| Species | Human |
| Genomic Locus | chr10:113721687 |
| Transcript | NM_001267056 |
| WT Expression Level | 25.02 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce two subunits, large and small, that dimerize to form the active enzyme. The precursor of the encoded protein is cleaved by caspase 3 and 10, is activated upon cell death stimuli and induces apoptosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp deletion in a coding exon of CASP7. |
| Description | 2bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GAAGCACTTGAAGAGCGCCT |
| PCR Primer |
Forward: TGGAAGGCATTGTATATACTTGGAGT Reverse: AAAATTTCAAGATAGGGTGTTGCCA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.