Online Inquiry
Camk4 cDNA ORF Clone, Mouse, N-Myc tag
SPD-02086
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse calcium/calmodulin-dependent protein kinase IV with N terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | CaMKIV |
| Gene Abbr. | Camk4 |
| Gene ID | 12326 |
| Full Name | calcium/calmodulin-dependent protein kinase IV |
| Alias | A430110E23Rik, AI666733, CaM, CaMKI, CaMKIV |
| Introduction | CaMKIV is an important member of calcium/calmodulin-activated kinases. CaMKIV signaling has been related to long-term neural potentiation and memory, as well as T-cell receptor signaling. CaMKIV has catalytic and regulatory domains. The Ca2+/calmodulin-dependent CaMKK phosphorylates CaMKIV, releasing the autoinhibitory effect and thus activating the kinase. The activated CaMKIV further autophosphorylates itself at Thr196 (or Thr200 in human) to render the kinase constitutively active. The threonine phosphorylation state of CaMKIV can be downregulated by PP2A dephosphorylation. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse calcium/calmodulin-dependent protein kinase IV with N terminal Myc tag. |
| NCBI Ref Seq | NM_009793.3 |
| RefSeq ORF Size | 1410 bp |
| Vector | pCMV3-N-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.