Online Inquiry
BTRC cDNA ORF Clone, Human, untagged
SPD-15810
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human beta-transducin repeat containing E3 ubiquitin protein ligase. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | β-TrCP |
| Gene Abbr. | BTRC |
| Gene ID | 8945 |
| Full Name | beta-transducin repeat containing E3 ubiquitin protein ligase |
| Alias | BETA-TRCP, FBW1A, FBXW1, FBXW1A, FWD1 |
| Introduction | β-transducin repeat-containing protein (β-TrCP or FBW1A) is an F-box family protein characterized by the presence of the protein-protein mediating F-box domain first described in cyclin F. F-box proteins act as substrate adaptors that target proteins containing a specific phosphorylated sequence element, referred to as a phosphodegron, to the SCF E3 ubiquitin ligase complex for ubiquitination. β-TrCP targets many important proteins with diverse functions, such as p53, H-Ras, Smad4, IκBα, β-catenin, and the cell cycle checkpoint protein claspin, for ubiquitin-mediated degradation. Research studies have shown that inhibition of β-TrCP expression has a demonstrated benefit in the treatment of prostate cancer. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human beta-transducin repeat containing E3 ubiquitin protein ligase. |
| NCBI Ref Seq | NM_003939.4 |
| RefSeq ORF Size | 1710 bp |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.