Online Inquiry
BTK cDNA ORF Clone, Human, N-HA tag
SPD-01727
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human Bruton agammaglobulinemia tyrosine kinase with N terminal HA tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | Btk |
| Gene Abbr. | BTK |
| Gene ID | 695 |
| Full Name | Bruton tyrosine kinase |
| Alias | AGMX1, AT, ATK, BPK, IGHD3 |
| Introduction | Bruton's tyrosine kinase (Btk) is a member of the Btk/Tec family of cytoplasmic tyrosine kinases. Like other Btk family members, it contains a pleckstrin homology (PH) domain and Src homology SH3 and SH2 domains. Btk plays an important role in B cell development. Activation of B cells by various ligands is accompanied by Btk membrane translocation mediated by its PH domain binding to phosphatidylinositol-3,4,5-trisphosphate. The membrane-localized Btk is active and associated with transient phosphorylation of two tyrosine residues, Tyr551 and Tyr223. Tyr551 in the activation loop is transphosphorylated by the Src family tyrosine kinases, leading to autophosphorylation at Tyr223 within the SH3 domain, which is necessary for full activation. The activation of Btk is negatively regulated by PKCβ through phosphorylation of Btk at Ser180, which results in reduced membrane recruitment, transphosphorylation, and subsequent activation. The PKC inhibitory signal is likely to be a key determinant of the B cell receptor signaling threshold to maintain optimal Btk activity. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human Bruton agammaglobulinemia tyrosine kinase with N terminal HA tag. |
| NCBI Ref Seq | NM_000061.2 |
| RefSeq ORF Size | 2022 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1941C/T not causing the amino acid variation. |
| Vector | pCMV3-N-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Restriction Sites | KpnI + XbaI (6kb + 2.02kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.