Online Inquiry
BCL2L11 cDNA ORF Clone, Human, C-HA tag
SPD-01608
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human BCL2-like 11 (apoptosis facilitator) with C terminal HA tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | BIM |
| Gene Abbr. | BCL2L11 |
| Gene ID | 10018 |
| Full Name | BCL2 like 11 |
| Alias | BAM, BIM, BOD |
| Introduction | Bim/Bod is a pro-apoptotic protein belonging to the BH3-only group of Bcl-2 family members including Bad, Bid, Bik, Hrk, and Noxa that contain a BH3 domain but lack other conserved BH1 or BH2 domains. Bim induces apoptosis by binding to and antagonizing anti-apoptotic members of the Bcl-2 family. Interactions have been observed with Bcl-2, Bcl-xL, Mcl-1, Bcl-w, Bfl-1, and BHRF-1. Bim functions in regulating apoptosis associated with thymocyte negative selection and following growth factor withdrawal, during which Bim expression is elevated. Three major isoforms of Bim are generated by alternative splicing: BimEL, BimL, and BimS. The shortest form, BimS, is the most cytotoxic and is generally only transiently expressed during apoptosis. The BimEL and BimL isoforms may be sequestered to the dynein motor complex through an interaction with the dynein light chain and released from this complex during apoptosis. Apoptotic activity of these longer isoforms may be regulated by phosphorylation. Environmental stress triggers Bim phosphorylation by JNK and results in its dissociation from the dynein complex and increased apoptotic activity. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human BCL2-like 11 (apoptosis facilitator) with C terminal HA tag. |
| NCBI Ref Seq | BC033694 |
| RefSeq ORF Size | 597 bp |
| Vector | pCMV3-C-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.