BCL2A1 cDNA ORF Clone, Human, N-FLAG tag - CD BioSciences

service-banner

BCL2A1 cDNA ORF Clone, Human, N-FLAG tag

BCL2A1 cDNA ORF Clone, Human, N-FLAG tag

SPD-00251

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human BCL2-related protein A1,transcript variant 1 with N terminal Flag tag.
Target Information
Species Human
Target Name A1/Bfl-1
Gene Abbr. BCL2A1
Gene ID 597
Full Name BCL2 related protein A1
Alias ACC-1, ACC-2, ACC1, ACC2, BCL2L5
Introduction The Bcl-2-related protein A1 (Bfl-1, BCL2A1) is an anti-apoptotic member of the Bcl-2 family originally cloned from mouse bone marrow as a granulocyte macrophage-colony stimulating factor (GM-CSF)-inducible gene. Expression of A1/Bfl-1 is primarily restricted to hematopoietic cells, although it has been detected in some non-hematopoietic tissues including lung and in endothelial cells. A1/Bfl-1 protein is rapidly induced by NF-κB and is elevated in response to a variety of factors that stimulate this pathway, including TNF-α and IL-1β, CD40, phorbol ester, and LPS. As with other Bcl-2 family proteins, A1/Bfl-1 functions by binding and antagonizing pro-apoptotic members of the family (Bid, Bim), which inhibits release of mitochondrial cytochrome c. In contrast, research studies indicate that the enzyme calpain cleaves A1/Bfl-1 at specific sites within the amino terminal region, creating pro-apoptotic, carboxy-terminal fragments that promote mitochondrial release of cytochrome c and apoptosis. Studies suggest a possible therapeutic strategy of targeting apoptosis through use of the specific A1/Bfl-1 cleavage fragments.
Product Details
Description Full length Clone DNA of Human BCL2-related protein A1,transcript variant 1 with N terminal Flag tag.
NCBI Ref Seq NM_004049.3
RefSeq ORF Size 567 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-N-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + NotI (6kb + 0.57kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.