Online Inquiry
BAD cDNA ORF Clone, Human, untagged
SPD-01385
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human BCL2-antagonist of cell death (BAD), transcript variant 1. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | BAD |
| Gene Abbr. | BAD |
| Gene ID | 572 |
| Full Name | BCL2 associated agonist of cell death |
| Alias | BBC2, BCL2L8 |
| Introduction | Bad is a proapoptotic member of the Bcl-2 family that promotes cell death by displacing Bax from binding to Bcl-2 and Bcl-xL. Survival factors, such as IL-3, inhibit the apoptotic activity of Bad by activating intracellular signaling pathways that result in the phosphorylation of Bad at Ser112 and Ser136. Phosphorylation at these sites promotes binding of Bad to 14-3-3 proteins to prevent an association between Bad with Bcl-2 and Bcl-xL. Akt phosphorylates Bad at Ser136 to promote cell survival. Bad is phosphorylated at Ser112 both in vivo and in vitro by p90RSK and mitochondria-anchored PKA. Phosphorylation at Ser155 in the BH3 domain by PKA plays a critical role in blocking the dimerization of Bad and Bcl-xL. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human BCL2-antagonist of cell death (BAD), transcript variant 1. |
| NCBI Ref Seq | NM_004322.2 |
| RefSeq ORF Size | 507 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | HindIII + XbaI (6.1kb + 0.51kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.