Online Inquiry
Atf2 cDNA ORF Clone, Mouse, N-Myc tag
SPD-01060
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Mouse activating transcription factor 2, isfrom 1 with N terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Mouse |
| Target Name | ATF-2 |
| Gene Abbr. | Atf2 |
| Gene ID | 11909 |
| Full Name | activating transcription factor 2 |
| Alias | ATF-, Atf-2, CRE-, CRE-BP, Creb |
| Introduction | The transcription factor ATF-2 (also called CRE-BP1) binds to both AP-1 and CRE DNA response elements and is a member of the ATF/CREB family of leucine zipper proteins. ATF-2 interacts with a variety of viral oncoproteins and cellular tumor suppressors and is a target of the SAPK/JNK and p38 MAP kinase signaling pathways. Various forms of cellular stress, including genotoxic agents, inflammatory cytokines, and UV irradiation, stimulate the transcriptional activity of ATF-2. Cellular stress activates ATF-2 by phosphorylation of Thr69 and Thr71. Both SAPK and p38 MAPK have been shown to phosphorylate ATF-2 at these sites in vitro and in cells transfected with ATF-2. Mutations of these sites result in the loss of stress-induced transcription by ATF-2. In addition, mutations at these sites reduce the ability of E1A and Rb to stimulate gene expression via ATF-2.ATF-7 is another member of the ATF/CREB family of leucine zipper proteins. Similarly, Thr51 and Thr53 (corresponding to Thr69 and Thr71 of ATF-2, respectively) can be phosphorylated under different conditions. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Mouse activating transcription factor 2, isfrom 1 with N terminal Myc tag. |
| NCBI Ref Seq | NM_001025093.1 |
| RefSeq ORF Size | 1464 bp |
| Vector | pCMV3-N-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.