Online Inquiry
ARRB2 cDNA ORF Clone, Human, untagged
SPD-15779
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human arrestin, beta 2. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | β-Arrestin 2 |
| Gene Abbr. | ARRB2 |
| Gene ID | 409 |
| Full Name | arrestin beta 2 |
| Alias | ARB2, ARR2, BARR2 |
| Introduction | Arrestin proteins function as negative regulators of G protein-coupled receptor (GPCR) signaling. Cognate ligand binding stimulates GPCR phosphorylation, which is followed by binding of arrestin to the phosphorylated GPCR and the eventual internalization of the receptor and desensitization of GPCR signaling. Four distinct mammalian arrestin proteins are known. Arrestin 1 (also known as S-arrestin) and arrestin 4 (X-arrestin) are localized to retinal rods and cones, respectively. Arrestin 2 (also known as β-arrestin 1) and arrestin 3 (β-arrestin 2) are ubiquitously expressed and bind to most GPCRs. β-arrestins function as adaptor and scaffold proteins and play important roles in other processes, such as recruiting c-Src family proteins to GPCRs in Erk activation pathways. β-arrestins are also involved in some receptor tyrosine kinase signaling pathways. Additional evidence suggests that β-arrestins translocate to the nucleus and help regulate transcription by binding transcriptional cofactors. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human arrestin, beta 2. |
| NCBI Ref Seq | BC007427 |
| RefSeq ORF Size | 1230 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 1.23kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.