Aph1a cDNA ORF Clone, Rat, untagged - CD BioSciences

service-banner

Aph1a cDNA ORF Clone, Rat, untagged

Aph1a cDNA ORF Clone, Rat, untagged

SPD-00761

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rat APH1A gamma secretase subunit.
Target Information
Species Rat
Target Name APH1A
Gene Abbr. Aph1a
Gene ID 365872
Full Name aph-1 homolog A, gamma secretase subunit
Alias RGD1311546
Product Details
Description Full length Clone DNA of Rat APH1A gamma secretase subunit.
NCBI Ref Seq NM_001014255.1
RefSeq ORF Size 744 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.