Online Inquiry
AKR1B10 Knockout Cell Line
SPL-00180
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | AKR1B10 |
| Gene Abbr. | AKR1B10 |
| Gene ID | 57016 |
| Full Name | aldo-keto reductase family 1 member B10 |
| Alias | AKR1B11, AKR1B12, ALDRLn, ARL-1, ARL1 |
| Species | Human |
| Genomic Locus | chr7:134533031 |
| Transcript | NM_020299 |
| WT Expression Level | 0.07 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member can efficiently reduce aliphatic and aromatic aldehydes, and it is less active on hexoses. It is highly expressed in adrenal gland, small intestine, and colon, and may play an important role in liver carcinogenesis. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of AKR1B10. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GATAAAGGTAATGCCATCGG |
| PCR Primer |
Forward: GCAGATGTGGTATTTAGCAAGAGTC Reverse: AGTATCAGATGTACCCAAAAGCCAA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.